<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
	<ui>1475-9292-4-5</ui>
	<ji>1475-9292</ji>
	<fm>
		<dochead>Original research</dochead>
		<bibl>
			<title><p>Detection of trypanosomes in small ruminants and pigs in western Kenya: important reservoirs in the epidemiology of sleeping sickness?</p>
			</title>
			<aug>
				<au id="A1">
					<snm>Ng'ayo</snm>
					<mi>O</mi>
					<fnm>Musa</fnm>
					<insr iid="I1"/>
					<insr iid="I2"/>
					<email>motieno@nairobi.mimcom.net</email>
				</au>
				<au id="A2">
					<snm>Njiru</snm>
					<mi>K</mi>
					<fnm>Zablon</fnm>
					<insr iid="I3"/>
					<insr iid="I4"/>
					<email>zknjiru@hotmail.com</email>
				</au>
				<au id="A3">
					<snm>Kenya</snm>
					<mi>U</mi>
					<fnm>Eucharia</fnm>
					<insr iid="I1"/>
					<email>ukunomakenya@yahoo.com</email>
				</au>
				<au id="A4">
					<snm>Muluvi</snm>
					<mi>M</mi>
					<fnm>Geoffrey</fnm>
					<insr iid="I1"/>
					<email>gmmuluvi@avu.org</email>
				</au>
				<au id="A5">
					<snm>Osir</snm>
					<mi>O</mi>
					<fnm>Ellie</fnm>
					<insr iid="I2"/>
					<email>eosir@icipe.org</email>
				</au>
				<au id="A6" ca="yes">
					<snm>Masiga</snm>
					<mi>K</mi>
					<fnm>Daniel</fnm>
					<insr iid="I1"/>
					<insr iid="I2"/>
					<email>dmasiga@icipe.org</email>
				</au>
			</aug>
			<insg><ins id="I1">
					<p>Department of Biochemistry and Biotechnology, Kenyatta University, P.O. Box 43844, 00100 &#8211; Nairobi, Kenya</p>
				</ins>
				<ins id="I2">
					<p>Molecular Biology and Biochemistry Department, International Centre of Insect Physiology and Ecology, Duduville, Kasarani, P.O. Box 30772, 00100 &#8211; Nairobi, Kenya</p>
				</ins>
				<ins id="I3">
					<p>Trypanosomiasis Research Centre, Kenya Agricultural Research Institute, P.O. Box 362, Kikuyu, Kenya</p>
				</ins>
				<ins id="I4">
					<p>Western Australia Biomedical Research Institute, Division of Health Sciences, School of Veterinary and Biomedical Sciences, Murdoch University, Murdoch, WA 6150, Australia</p>
				</ins>
			</insg>
			<source>Kinetoplastid Biology and Disease</source>
			<issn>1475-9292</issn>
			<pubdate>2005</pubdate>
			<volume>4</volume>
			<issue>1</issue>
			<fpage>5</fpage><url>http://www.kinetoplastids.com/content/4/1/5</url>
			<xrefbib>
				<pubidlist>
					<pubid idtype="pmpid">16018802</pubid>
					<pubid idtype="doi">10.1186/1475-9292-4-5</pubid>
				</pubidlist>
			</xrefbib>
		</bibl>
		<history>
			<rec>
				<date>
					<day>28</day>
					<month>9</month>
					<year>2004</year>
				</date>
			</rec>
			<acc>
				<date>
					<day>14</day>
					<month>7</month>
					<year>2005</year>
				</date>
			</acc>
			<pub>
				<date>
					<day>14</day>
					<month>7</month>
					<year>2005</year>
				</date>
			</pub>
		</history>
		<cpyrt>
			<year>2005</year>
			<collab>Ng'ayo et al; licensee BioMed Central Ltd.</collab>
			<note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note></cpyrt>
		<kwdg><kwd><it>Trypanosoma brucei rhodesiense</it></kwd><kwd>Human African Trypanosomosis, sleeping sickness, epidemiology</kwd><kwd>Serum Resistance Associated (SRA) gene</kwd><kwd>small ruminants</kwd>
			<kwd>pigs</kwd><kwd>reservoirs.</kwd></kwdg>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<sec>
					<st><p>Background</p></st><p>Trypanosomosis is a major impediment to livestock farming in sub-Saharan Africa and limits the full potential of agricultural development in the 36 countries where it is endemic. In man, sleeping sickness is fatal if untreated and causes severe morbidity. This study was undertaken in western Kenya, an area that is endemic for both human and livestock trypanosomosis. While trypanosomosis in livestock is present at high levels of endemicity, sleeping sickness occurs at low levels over long periods, interspersed with epidemics, underscoring the complexity of the disease epidemiology. In this study, we sought to investigate the prevalence of trypanosomes in small ruminants and pigs, and the potential of these livestock as reservoirs of potentially human-infective trypanosomes. The study was undertaken in 5 villages, to address two key questions: i) are small ruminants and pigs important in the transmission dynamics of trypanosomosis? and ii), do they harbour potentially human infective trypanosomes? Answers to these questions are important in developing strategies for the control of both livestock and human trypanosomosis.</p></sec>
				<sec>
					<st><p>Results</p></st><p>Eighty-six animals, representing 21.3% of the 402 sampled in the 5 villages, were detected as positive by PCR using a panel of primers that identify trypanosomes to the level of the species and sub-species. These were categorised as 23 (5.7%) infections of <it>T. vivax</it>, 22 (5.5%) of <it>T. simiae</it>, 21 (5.2%) of the <it>T. congolense </it>clade and 20 (5.0%) of <it>T. brucei </it>ssp. The sheep was more susceptible to trypanosome infection as compared to goats and pigs. The 20 <it>T. brucei </it>positive samples were evaluated by PCR for the presence of the Serum Resistance Associated (SRA) gene, which has been linked to human infectivity in <it>T. b. rhodesiense</it>. Three samples (one pig, one sheep and one goat) were found to have the SRA gene. These results suggest that sheep, goats and pigs, which are kept alongside cattle, may harbour human-infective trypanosomes.</p></sec>
				<sec>
					<st><p>Conclusion</p></st><p>We conclude that all livestock kept in this <it>T. b. rhodesiense </it>endemic area acquire natural infections of trypanosomes, and are therefore important in the transmission cycle. Sheep, goats and pigs harbour trypanosomes that are potentially infective to man. Hence, the control of trypanosomosis in these livestock is essential to the success of any strategy to control the disease in man and livestock.</p></sec>
			</sec>
		</abs>
	</fm>
	<bdy>
		<sec>
			<st>
				<p>Background</p>
			</st>
			<p>African trypanosomosis has profoundly affected settlement and economic development in much of the African continent, especially south of the Sahara desert where it is transmitted mainly by tsetse flies. Overlaying a map of the distribution of livestock and that of tsetse infestation highlights the extent to which tsetse and trypanosomosis impede livestock development <abbrgrp>
					<abbr bid="B1">1</abbr>
				</abbrgrp>. Additionally, sleeping sickness or Human African Trypanosomosis (HAT) is responsible for considerable morbidity and mortality in many countries of sub-Saharan Africa. Sleeping sickness is caused by two protozoan parasites of genus <it>Trypanosoma</it>: <it>Trypanosoma brucei rhodesiense </it>and <it>T. b. gambiense</it>. The latter is characterized by a chronic disease in man, often lasting several years, and is distributed mainly in western and central Africa. <it>T. b. rhodesiense </it>is more acute, with clinical signs apparent within weeks of infection and is confined to eastern and southern Africa. For a long time, wildlife were considered the most important, perhaps the only reservoir for both sleeping sickness and trypanosomosis in livestock. However, this changed when it was demonstrated that cattle were reservoirs of <it>T. b. rhodesiense </it>in Kenya <abbrgrp>
					<abbr bid="B2">2</abbr>
				</abbrgrp>. With respect to <it>T. b. gambiense </it>on the other hand, it has been shown that pigs are reservoirs <abbrgrp>
					<abbr bid="B3">3</abbr>
				</abbrgrp>, although a direct man-fly-man transmission cycle is considered the more important <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>. The acute nature of sleeping sickness due to <it>T. b. rhodesiense </it>appears to preclude this, making the presence of a non-human reservoir obligatory in maintaining an endemic focus. Recent cases from areas where wildlife are protected, such as Serengeti National Park in Tanzania, indicate that wildlife continue to play a role in transmission of sleeping sickness <abbrgrp>
					<abbr bid="B5">5</abbr>
				</abbrgrp>.</p>
			<p>Unlike cattle, sheep and goats are kept in a very broad range of agro-ecological zones <abbrgrp>
					<abbr bid="B1">1</abbr>
				</abbrgrp>, where they contribute considerably to the rural economies as a source of meat, milk, manure and readily disposable income <abbrgrp>
					<abbr bid="B6">6</abbr>
				</abbrgrp>. Early reports suggested that trypanosomosis was not an important disease in small ruminants <abbrgrp>
					<abbr bid="B7">7</abbr>
				</abbrgrp>. However, more recent studies have clearly demonstrated that sheep and goats acquire natural infections <abbrgrp>
					<abbr bid="B8">8</abbr>
					<abbr bid="B9">9</abbr>
					<abbr bid="B10">10</abbr>
					<abbr bid="B11">11</abbr>
					<abbr bid="B12">12</abbr>
				</abbrgrp>, and suffer economic loss <abbrgrp>
					<abbr bid="B13">13</abbr>
					<abbr bid="B14">14</abbr>
				</abbrgrp>. Trypanosomes have also been shown to infect pigs, with reports of natural infections in different regions of Africa <abbrgrp>
					<abbr bid="B9">9</abbr>
					<abbr bid="B11">11</abbr>
					<abbr bid="B15">15</abbr>
					<abbr bid="B16">16</abbr>
				</abbrgrp>.</p>
			<p>This study was undertaken in western Kenya, an area that is endemic for Human African Trypanosomosis (HAT) or sleeping sickness, and several species of trypanosomes of veterinary importance. We sought to investigate the role of small ruminants and pigs in the transmission dynamics of trypanosomosis. In this area, pigs are increasingly kept as free-range livestock, presumably thriving as a result of the varied nature of their diet. Our efforts to identify <it>T. b. rhodesiense </it>have benefited from evidence that the Serum Resistance Associated gene (SRA) is ubiquitous among all <it>T. b. rhodesiense </it>isolates tested so far that have also been characterized by other biochemical criteria <abbrgrp>
					<abbr bid="B17">17</abbr>
					<abbr bid="B18">18</abbr>
					<abbr bid="B19">19</abbr>
				</abbrgrp>.</p>
		</sec>
		<sec>
			<st>
				<p>Results</p>
			</st>
			<sec>
				<st>
					<p>Detection of trypanosomes</p>
				</st>
				<p>The buffy coat and haematocrit centrifuge technique (HCT) <abbrgrp>
						<abbr bid="B20">20</abbr>
					</abbrgrp> examination of blood from the 402 animals detected 5 trypanosome infections as shown in Table <tblr tid="T1">1</tblr>. The infections detected by microscopy were one <it>T. congolense</it>, one <it>T. vivax </it>and three <it>T. brucei</it>; no mixed infections were detected using microscopy alone. All 402 animals sampled were subjected to PCR analysis for detection of trypanosomes, based on primers specific for different species and subspecies (Table <tblr tid="T2">2</tblr>). Eighty-six (18.9%) animals out of the 402 were found infected by PCR. Thirty-one (27.7%) out of 112 animals sampled from Obuchun were infected by various species of trypanosomes. The infection rate was 28.05% (23/82) in Amoni, 22.1% (15/68) in Ongariama, 19.2% (10/52) in Amase and 7.9% (7/88) in Rukada. Twenty-four of the 95 sheep sampled (25.3%) were infected, while 52/255 goats (20.0%) and 10/52 pigs (19.2%) were infected. There was no significant difference in infection between animals (<it>p </it>> 0.05).</p>
				<tbl id="T1" hint_layout="single">
					<title>
						<p>Table 1</p>
					</title>
					<caption>
						<p>Identification of trypanosome species using PCR.</p>
					</caption>
					<tblbdy cols="9">
						<r>
							<c ca="left">
								<p>
									<b>Amoni</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c cspan="9">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Goats</p>
							</c>
							<c ca="left">
								<p>42</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
							<c ca="left">
								<p>3</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
							<c ca="left">
								<p>8</p>
							</c>
							<c ca="left">
								<p>
									<b>19.04</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Sheep</p>
							</c>
							<c ca="left">
								<p>37</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>6</p>
							</c>
							<c ca="left">
								<p>5</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>4</p>
							</c>
							<c ca="left">
								<p>15</p>
							</c>
							<c ca="left">
								<p>
									<b>40.54</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pigs</p>
							</c>
							<c ca="left">
								<p>3</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>
									<b>0</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="9">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Amase</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Goats</p>
							</c>
							<c ca="left">
								<p>35</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>4</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>5</p>
							</c>
							<c ca="left">
								<p>
									<b>14.29</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Sheep</p>
							</c>
							<c ca="left">
								<p>8</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>
									<b>12.5</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pigs</p>
							</c>
							<c ca="left">
								<p>9</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
							<c ca="left">
								<p>4</p>
							</c>
							<c ca="left">
								<p>
									<b>44.44</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="9">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Ongariama</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Goats</p>
							</c>
							<c ca="left">
								<p>55</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>7</p>
							</c>
							<c ca="left">
								<p>5</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>13</p>
							</c>
							<c ca="left">
								<p>
									<b>23.64</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Sheep</p>
							</c>
							<c ca="left">
								<p>7</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>
									<b>0</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pigs</p>
							</c>
							<c ca="left">
								<p>6</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
							<c ca="left">
								<p>
									<b>33.33</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="9">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Obuchun</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Goats</p>
							</c>
							<c ca="left">
								<p>86</p>
							</c>
							<c ca="left">
								<p>4</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>8</p>
							</c>
							<c ca="left">
								<p>8</p>
							</c>
							<c ca="left">
								<p>3</p>
							</c>
							<c ca="left">
								<p>23</p>
							</c>
							<c ca="left">
								<p>
									<b>26.74</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Sheep</p>
							</c>
							<c ca="left">
								<p>13</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
							<c ca="left">
								<p>4</p>
							</c>
							<c ca="left">
								<p>
									<b>30.77</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pigs</p>
							</c>
							<c ca="left">
								<p>13</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>3</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>4</p>
							</c>
							<c ca="left">
								<p>
									<b>30.77</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="9">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Rukada</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Goats</p>
							</c>
							<c ca="left">
								<p>37</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>3</p>
							</c>
							<c ca="left">
								<p>
									<b>8.11</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Sheep</p>
							</c>
							<c ca="left">
								<p>30</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>1</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
							<c ca="left">
								<p>4</p>
							</c>
							<c ca="left">
								<p>
									<b>13.33</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pigs</p>
							</c>
							<c ca="left">
								<p>21</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>0</p>
							</c>
							<c ca="left">
								<p>
									<b>0</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="9">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="right">
								<p>
									<b>TOTAL</b>
								</p>
							</c>
							<c ca="right">
								<p>
									<b>402</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>9</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>12</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>22</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>23</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>20</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>86</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>21.39%</b>
								</p>
							</c>
						</r>
					</tblbdy>
				</tbl>
				<tbl id="T2" hint_layout="double">
					<title>
						<p>Table 2</p>
					</title>
					<caption>
						<p>Sequences of primers used for PCR and expected product size</p>
					</caption>
					<tblbdy cols="4">
						<r>
							<c ca="left">
								<p>
									<b>Trypanosome species</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>Primer sequence 5'-3'</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>Size (bp)</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>Reference</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="4">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>T. Congolense </it>savannah</p>
							</c>
							<c ca="left">
								<p>For: CGAGAACGGGCACTTTGCGA</p>
							</c>
							<c ca="left">
								<p>316</p>
							</c>
							<c ca="left">
								<p>[28]</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Rev: GGACAAACAAATCCCGCACA</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>T. congolense </it>Kilifi</p>
							</c>
							<c ca="left">
								<p>For: GTGACCAAATTTGAAGTGAT</p>
							</c>
							<c ca="left">
								<p>294</p>
							</c>
							<c ca="left">
								<p>[28]</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Rev: ACTCAAAATCGTGCACCTCG</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>T. vivax</it>
								</p>
							</c>
							<c ca="left">
								<p>For: CCCGGCAGGTTGGCCGCCATC</p>
							</c>
							<c ca="left">
								<p>399</p>
							</c>
							<c ca="left">
								<p>[29]</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Rev: TCGCTACCACAGTCGCAATCGCAATCGTCGTCTCAAGG</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>T. simiae</it>
								</p>
							</c>
							<c ca="left">
								<p>For: CCGGTCAAAAACGCATT</p>
							</c>
							<c ca="left">
								<p>437</p>
							</c>
							<c ca="left">
								<p>[28]</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Rev: AGTCGCCCGGAGTCGAT</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>T. brucei</it>
								</p>
							</c>
							<c ca="left">
								<p>For: GAATATTAAACAATGCGCAG</p>
							</c>
							<c ca="left">
								<p>164</p>
							</c>
							<c ca="left">
								<p>[28]</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Rev: CCATTTATTAGCTTTGTTGC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<it>SRA &#8211; T. b. rhodesiense</it>
								</p>
							</c>
							<c ca="left">
								<p>SRA-A: 5'GACAACAAGTACCTTGGCGC</p>
							</c>
							<c ca="left">
								<p>460</p>
							</c>
							<c ca="left">
								<p>[18]</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>SRA-E: 5'TACTGTTGTTGTACCGCCGC)</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
					</tblbdy>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>Prevalence of trypanosome species</p>
				</st>
				<p>The prevalence of <it>Trypanosoma vivax </it>as detected by PCR was 23 (5.7%), <it>T. simiae </it>22 (5.5%), <it>T. congolense </it>savannah 9 (2.2%), <it>T. congolense </it>Kilifi 12 (3.0%) and <it>T. brucei </it>ssp 20 (5.0%). A number of mixed infections were reported in this study; <it>T. congolense </it>Savannah and <it>T. brucei </it>were encountered twice, and there was one mixed infection of <it>T. congolen</it>se savannah and <it>T. simiae</it>. Sheep carried significantly more infections of <it>T. congolense </it>Kilifi than goats (&#967;<sup>2 </sup>= 9.8, df = 1, <it>p </it>&lt; 0.05) and similarly with <it>T. brucei </it>ssp (&#967;<sup>2 </sup>= 6.6, df = 1, <it>p </it>&lt; 0.05). There were more <it>T. vivax </it>infections in goats and pigs than in sheep respectively, and this difference was significant (<it>p </it>&lt; 0.05).</p>
			</sec>
			<sec>
				<st>
					<p>Presence of Serum Resistance Associated (SRA) Gene</p>
				</st>
				<p>Twenty samples in which T. brucei spp. was detected by PCR were further analysed for the presence of the SRA. This analysis resulted in 3 positive samples for the SRA gene (from a goat, pig and sheep) (Figure <figr fid="F1">1</figr>), demonstrating the presence of this gene associated with human infectivity in trypanosomes infecting livestock other than cattle.</p>
				<fig id="F1">
					<title><p>Figure 1</p>
					</title>
					<caption><p>Map of study area showing sampling locations</p>
					</caption>
					<text>
						<p>
							<b>Map of study area showing sampling locations. </b>Sampling was undertaken in 5 villages (4 in Teso and 1 in Busia Districts), whose GPS locations are shown in this map.</p>
					</text>
					<graphic file="1475-9292-4-5-1" hint_layout="double"/>
				</fig>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Discussion</p>
			</st>
			<sec>
				<st>
					<p>Trypanosomes in small ruminants</p>
				</st>
				<p>Few records exist on the effect of trypanosomosis in small ruminants in East Africa. However, the work of Griffin and Allonby <abbrgrp>
						<abbr bid="B8">8</abbr>
						<abbr bid="B13">13</abbr>
					</abbrgrp>, who used microscopic examination of blood smears to demonstrate that the disease was an important natural infection, is a notable exception. These authors also reported that small ruminants survived better than cattle under medium tsetse challenge. More recent studies undertaken in an area of high tsetse fly challenge have shown that small ruminants succumb to trypanosomosis and that heavy economic loss is occasioned <abbrgrp>
						<abbr bid="B12">12</abbr>
						<abbr bid="B14">14</abbr>
					</abbrgrp>. Although the microscopic techniques used in these studies have limitations of sensitivity <abbrgrp>
						<abbr bid="B20">20</abbr>
					</abbrgrp>, they provided an important basis for investigations into the importance of trypanosomosis in small ruminants. In the present study, using PCR raised the number of infections detected from 5 to 86, considerably improving our understanding of the prevalence of trypanosomosis in small ruminants and pigs.</p>
				<p>A greater percentage of sheep were infected compared to goats and pigs, findings that are consistent with other studies that have shown sheep to be more frequently infected than goats under natural conditions <abbrgrp>
						<abbr bid="B9">9</abbr>
						<abbr bid="B11">11</abbr>
						<abbr bid="B12">12</abbr>
					</abbrgrp>, <abbrgrp>
						<abbr bid="B21">21</abbr>
						<abbr bid="B22">22</abbr>
						<abbr bid="B23">23</abbr>
						<abbr bid="B24">24</abbr>
					</abbrgrp>. All these findings, drawn from experiments on different breeds suggest that goats are more refractory to trypanosome infections than sheep. The presence of many small ruminants with <it>T. simiae </it>(5 sheep and 16 goats) shows that this trypanosome has the potential to impact negatively on the growing importance of pig farming in the study area. Our data also show that sheep were more frequently infected with <it>T. congolense </it>Kilifi and <it>T. brucei</it>, while pigs and goats were more frequently infected with <it>T. vivax</it>.</p>
				<p>All the 5 villages, except Ongariama, had infections of <it>T. congolense</it>, arguably the most important pathogens of cattle in Africa. Also, with the exception of Rukada and Amoni, <it>T. vivax </it>infections were identified. These two species constitute the most important trypanosomes of livestock in Africa. Considering the greater trypanotolerance of small ruminants, they may be acting as reservoirs of these pathogens, therefore limiting the economic impact of the cattle industry.</p>
			</sec>
			<sec>
				<st>
					<p>Trypanosome infections in pigs</p>
				</st>
				<p>The presence of trypanosomes in pigs has been documented from different parts of Africa <abbrgrp>
						<abbr bid="B9">9</abbr>
						<abbr bid="B11">11</abbr>
						<abbr bid="B15">15</abbr>
						<abbr bid="B16">16</abbr>
					</abbrgrp>. In the present study, out of the 10 pigs infected, 3 carried <it>T. brucei </it>ssp., 5 had <it>T. vivax</it>, and there was one infection each of <it>T. congolen</it>se savannah and <it>T. simiae</it>. Of important relevance to sleeping sickness epidemiology, the SRA gene was detected in one pig carrying <it>T. brucei</it>. These data show that pigs play a role in the epidemiology of both human and animal trypanosomosis.</p>
			</sec>
			<sec>
				<st>
					<p>Reservoirs of sleeping sickness</p>
				</st>
				<p>Small ruminants and pigs constitute a key component of livestock kept in the study area. It is now well recognized that these livestock naturally acquire trypanosome infections. On the basis of DNA amplification of the SRA gene, this study shows that sheep, goats and pigs may harbour <it>T. b. rhodesiense</it>. It is in this context that investigations were undertaken in these livestock as potential reservoirs of <it>T. b. rhodesiense</it>. Reports implicating cattle date back to the infection of human subjects with pathogens isolated from cattle <abbrgrp>
						<abbr bid="B2">2</abbr>
					</abbrgrp>. In the intervening period, descriptions of human infective trypanosomes in cattle have been made on the basis of multilocus DNA fingerprinting <abbrgrp>
						<abbr bid="B15">15</abbr>
					</abbrgrp>, and more recently the presence of the SRA gene as a marker <abbrgrp>
						<abbr bid="B17">17</abbr>
						<abbr bid="B18">18</abbr>
					</abbrgrp>. The epidemiology of HAT in western Kenya is very complex, and key factors can vary within very short geographical distances. The existence of two species of tsetse flies, <it>G. pallidipes </it>and <it>G. fuscipes fuscipes</it>, which have different habitats, and feeding preferences, adds to this complexity. <it>G. fuscipes fuscipes </it>feeds primarily on the Nile monitor lizard, <it>Varanus niloticus </it>
					<abbrgrp>
						<abbr bid="B25">25</abbr>
					</abbrgrp>. This probably prompted experiments that led to the isolation of <it>T. brucei </it>from one monitor lizard <abbrgrp>
						<abbr bid="B26">26</abbr>
					</abbrgrp>, but the ability of these cold-blooded reptiles to support trypanosomes, other than Stercorarian forms such as <it>T. grayi </it>remains unconfirmed.</p>
				<p>The ability to identify <it>T. b. rhodesiense </it>in reservoirs and tsetse provides a means for estimating disease risk, even in the absence of current human infections. Our study also identified one pig that was infected with trypanosomes bearing the SRA gene. It is estimated that there are more than 10,000 pigs reared in a free-range management system in the area (Dr. Samuel Maina, personal communication). Their large number, and the evidence that they can act as reservoirs underscores the importance of this study on the health and economic development of rural Africa, even on a small geographical scale.</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Conclusion</p>
			</st>
			<p>To date, no significant efforts are made, either by the relevant government agents, or farmers to control trypanosomosis in small ruminants and pigs. This study contributes to the understanding of the epidemiology of sleeping sickness and livestock trypanosomosis in this area, with implications for the entire lake Victoria basin. Our conclusion is that small ruminants and pigs may constitute an enduring reservoir of trypanosomes that infect both humans and their livestock. Concerted efforts to control trypanosomes in these livestock can contribute significantly to a multi-disciplinary approach to trypanosomosis control in western Kenya, and other areas where the disease is endemic, and have an impact on the well being of the inhabitants of this region.</p>
		</sec>
		<sec>
			<st>
				<p>Methods</p>
			</st>
			<sec>
				<st>
					<p>Study area</p>
				</st>
				<p>The study area included two districts in western Kenya, Busia and Teso. Sampling was carried out in five villages: Rukada in Busia district; Amoni, Amase, Obuchun and Ongariama in Teso district (Figure <figr fid="F2">2</figr>). These villages were selected on the basis of having reported cases of sleeping sickness within a period of about 10 years prior to the study. Samples were collected in August 2001 over a period of two weeks. The two districts lie between latitude 0&#176; 1'South and 0&#176; 46' North; and longitude 33&#176; 54' West and 34&#176; 26' East (Figure <figr fid="F2">2</figr>). The altitude varies from 1130 m to 1375 m. The mean annual rainfall is 1500 mm divided between two seasons, while annual maximum temperature ranges from 26&#176;C to 30&#176;C and minimum temperatures vary from 14&#176;C to 18&#176;C. Busia District borders Lake Victoria and the entire study area is traversed by two tributaries (rivers Sio and Malaba) and several streams that feed into them. It is a mixed farming area, with a variety of livestock species, mainly cattle, sheep and goats. Over the past two decades, free-range pig rearing has increased steadily. Two species of tsetse flies (Diptera: <it>Glossinidae</it>) infest the area. <it>G. fuscipes fuscipes</it>, which is a riverine species, associated with rivers/streams and the shores of Lake Victoria, while <it>G. pallidipes </it>is more widely distributed and associated with shrubs, thickets and open grassland. The distribution of <it>G. pallidipes </it>is discontinuous and occurs in several small foci of infestation (Kenya Trypanosomiasis Research Institute, unpublished). In areas infested with <it>G. pallidipes</it>, bushes of <it>Lantana camara</it>, a suitable habitat for resting and larviposition are widespread.</p>
				<fig id="F2">
					<title><p>Figure 2</p>
					</title>
					<caption><p>Detection of SRA gene</p>
					</caption>
					<text>
						<p>
							<b>Detection of SRA gene. </b>Ethidium Bromide stained 1.5% agarose gel showing PCR identification of samples containing putative <it>T. b. rhodesiense </it>using SRA A and E primers. M, 100 bp DNA marker; NC, Negative Control, +, positive control. Lanes 1 (pig), 9 (sheep) and 14 (goat) show the expected fragment of 460 bp, which indicates the detection of the SRA gene in these samples.</p>
					</text>
					<graphic file="1475-9292-4-5-2" hint_layout="double"/>
				</fig>
			</sec>
			<sec>
				<st>
					<p>Animal sampling</p>
				</st>
				<p>Blood samples were collected from 402 animals (255 goats, 95 sheep and 52 pigs) that were brought to the sampling site by local farmers. The animals were bled from the ear vein into two capillary tubes. One capillary tube was used to estimate the percentage Packed Cell Volume (%PCV) and microscopic examination for trypanosomes, and also to make an initial diagnosis on the basis of morphology and movement <abbrgrp>
						<abbr bid="B20">20</abbr>
						<abbr bid="B27">27</abbr>
					</abbrgrp>. Animals were also bled from the jugular vein into 2 ml vials containing EDTA, and stored in liquid nitrogen for further analysis.</p>
			</sec>
			<sec>
				<st>
					<p>Template preparation and PCR cycling</p>
				</st>
				<p>For each sample, 500 &#956;l of cryopreserved blood was thawed into a single 1.5 ml microcentrifuge containing 500 &#956;l of Saponin lysis buffer (0.15% w/v Saponin, 0.2% w/v NaCl and 1 mM EDTA) and mixed by vortexing. The mixture was then centrifuged at 11,000 g for 10 min in a microcentrifuge, followed by four washes in the same buffer. The resulting pellet was then resuspended in 100 &#956;l of PCR buffer (50 mM KCl, 1.5 mM MgCl<sub>2 </sub>10 mM Tris-Cl, pH 8.3) and incubated at 95&#176;C for 20 minutes, cooled and stored at -20&#176;C for.</p>
				<p>Standard PCR cycling was carried out in 25 &#956;l reaction mixtures containing; 75 mM Tris-HCl, pH 8.8, 20 mM (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>, 0.1 % Tween 20), 200 &#956;M of each of the four deoxynucleoside triphosphates (dNTPs), primers at 1 &#956;M, 1 &#956;l DNA template (except for screening the presence of SRA gene, where 4 &#956;l of template was used), and 1 unit of <it>Taq </it>DNA polymerase (Fermentas MBI, Lithuania). The PCR cycling involved an initial denaturation step at 94&#176;C for 3 minutes, followed by 30 cycles of denaturing at 94&#176;C for 30 s, annealing at 60&#176;C for 45 s and extension at 72&#176;C for 30 s, with a final elongation step at 72&#176;C for 5 minutes. Five microlitres of each PCR product was mixed with standard loading dye (Fermentas MBI, Lithuania) and electrophoresed in 1.5% agarose, with ethidium staining (5 &#956;g/ml) and photographed under ultraviolet illumination. A positive control (with reference DNA) and a negative control (without DNA) were included with each set of reactions. PCR primers and their source references are given in Table <tblr tid="T2">2</tblr>.</p>
			</sec>
			<sec>
				<st>
					<p>Statistical analysis</p>
				</st>
				<p>Statistical analysis was performed using SPSS v11. The prevalence of trypanosome species and infection between animals were determined using chi-square test and odds ratios and their 95% confidence intervals. The level of significant difference was set at 0.05.</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Competing interests</p>
			</st>
			<p>The author(s) declare that they have no competing interests.</p>
		</sec>
		<sec>
			<st>
				<p>Authors' contributions</p>
			</st>
			<p>MNO undertook this study as part of his training for the Master of Science degree at Kenyatta University, where he was supervised by EUK and GMM. Field and laboratory activities were jointly supervised by ZKN (at KETRI), DKM and EOO (at ICIPE). All authors read and approved the final manuscript.</p>
		</sec>
	</bdy>
	<bm>
		<ack><sec><st>
					<p>Acknowledgements</p>
				</st>
				<p>The authors gratefully acknowledge funding from the International Foundation for Science, IFS and the International Centre for Scientific Culture (ICSC) &#8211; World Laboratory. This study was carried out at KETRI and ICIPE, and we gratefully acknowledge the support from the Directors of the two institutions. This study benefited from the excellent fieldwork with support from staff at the KETRI Alupe station, which we hereby acknowledge. We are grateful to Dr. George Matete, head of Alupe station at the time of the study for coordinating the sampling.</p>
			</sec></ack><refgrp>
			<bibl id="B1">
				<title>
					<p>The role of isometamidium chloride in chemoprophylaxis against trypanosomosis of small ruminants in Kenya</p>
				</title>
				<aug>
					<au>
						<snm>Okech</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Masinde</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Stevenson</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Ndung'u</snm>
						<fnm>JM</fnm>
					</au>
				</aug>
				<source>Proceedings of the 24th meeting of the International Scientific Council for Trypanosomiasis Research and Control (ISCTRC), Maputo, Mozambique)</source><publisher>Nairobi, OAU/STRC</publisher>
				<editor>Njogu AR</editor>
				<pubdate>1999</pubdate>
				<fpage>390</fpage>
				<lpage>397</lpage>
			</bibl>
			<bibl id="B2">
				<title>
					<p>The epidemiology of <it>Trypanosoma rhodesiense </it>sleeping sickness in Alego location central Nyanza, Kenya. I. Evidence that cattle may act as a reservoir host of trypanosomes infectious to man</p>
				</title>
				<aug>
					<au>
						<snm>Onyango</snm>
						<fnm>RJ</fnm>
					</au>
					<au>
						<snm>Van Hoeve</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>De Raadt</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Trans R Soc Trop Med Hyg</source><pubdate>1966</pubdate>
				<volume>60</volume>
				<fpage>175</fpage>
				<lpage>182</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/0035-9203(66)90024-1</pubid>
						<pubid idtype="pmpid">5950928</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B3">
				<title>
					<p>Epidemiological studies on the animal reservoir of Gambian sleeping sickness</p>
				</title>
				<aug>
					<au>
						<snm>Mehlitz</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Zillmann</snm>
						<fnm>U</fnm>
					</au>
					<au>
						<snm>Scott</snm>
						<fnm>CM</fnm>
					</au>
					<au>
						<snm>Godfrey</snm>
						<fnm>DG</fnm>
					</au>
				</aug>
				<source>Trypanozoon</source><pubdate>1982</pubdate>
				<volume>33</volume>
				<fpage>113</fpage>
				<lpage>118</lpage>
			</bibl>
			<bibl id="B4">
				<title>
					<p>Will the real <it>Trypanosoma brucei gambiense </it>please stand up?</p>
				</title>
				<aug>
					<au>
						<snm>Gibson</snm>
						<fnm>WC</fnm>
					</au>
				</aug>
				<source>Parasitol Today</source><pubdate>1986</pubdate>
				<volume>2</volume>
				<fpage>255</fpage>
				<lpage>257</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/0169-4758(86)90011-6</pubid>
						<pubid idtype="pmpid" link="fulltext">15462856</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B5">
				<title>
					<p>Cluster of African trypanosomiasis in travellers to Tanzanian national parks</p>
				</title>
				<aug>
					<au>
						<snm>Jelinek</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Bisoffi</snm>
						<fnm>Z</fnm>
					</au>
					<au>
						<snm>Bonazzi</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>van Thiel</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Bronner</snm>
						<fnm>U</fnm>
					</au>
					<au>
						<snm>de Frey</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Gundersen</snm>
						<fnm>SG</fnm>
					</au>
					<au>
						<snm>McWhinney</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Ripamonti</snm>
						<fnm>D</fnm>
					</au>
				</aug>
				<source>Emerging Infect Dis</source><pubdate>2002</pubdate>
				<volume>8</volume>
				<fpage>643</fpage>
				<lpage>635</lpage>
				<xrefbib>
					<pubid idtype="pmpid">12023923</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B6">
				<title>
					<p>Trypanosomiasis in small ruminants &#8211; a major constraint to livestock production</p>
				</title>
				<aug>
					<au>
						<snm>Luckins</snm>
						<fnm>AG</fnm>
					</au>
				</aug>
				<source>Brit Vet J</source><pubdate>1992</pubdate>
				<volume>148</volume>
				<fpage>471</fpage>
				<lpage>472</lpage>
			</bibl>
			<bibl id="B7">
				<title>
					<p>Clinical manifestations of the trypanosomiasis in livestock and other domestic animals</p>
				</title>
				<aug>
					<au>
						<snm>Stephen</snm>
						<fnm>LE</fnm>
					</au>
				</aug>
				<source>The African trypanosomiases (George Allen and UNWIM/Ministry of overseas Development, London)</source><pubdate>1970</pubdate>
				<fpage>774</fpage>
				<lpage>794</lpage>
			</bibl>
			<bibl id="B8">
				<title>
					<p>Disease syndromes in sheep and goats at a range research station in Kenya</p>
				</title>
				<aug>
					<au>
						<snm>Griffin</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Allonby</snm>
						<fnm>EW</fnm>
					</au>
				</aug>
				<source>J Comp Path</source><pubdate>1979</pubdate>
				<volume>89</volume>
				<fpage>457</fpage>
				<lpage>464</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/0021-9975(79)90037-9</pubid>
						<pubid idtype="pmpid">541451</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B9">
				<title>
					<p>The prevalence of trypanosomosis in small ruminants and pigs in a sleeping sickness endemic area of Buikwe country Mukono district, Uganda</p>
				</title>
				<aug>
					<au>
						<snm>Katunguka-Rwakishaya</snm>
						<fnm>E</fnm>
					</au>
				</aug>
				<source>Rev Elev Med Vet Trop</source><pubdate>1996</pubdate>
				<volume>49</volume>
				<fpage>56</fpage>
				<lpage>58</lpage>
			</bibl>
			<bibl id="B10">
				<title>
					<p>Observations on the prevalence of trypanosomiasis in small ruminants, equines and cattle, in relation to tsetse challenge, in The Gambia</p>
				</title>
				<aug>
					<au>
						<snm>Snow</snm>
						<fnm>WF</fnm>
					</au>
					<au>
						<snm>Wacher</snm>
						<fnm>TJ</fnm>
					</au>
					<au>
						<snm>Rawlings</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Vet Parasitol</source><pubdate>1996</pubdate>
				<volume>66</volume>
				<fpage>1</fpage>
				<lpage>11</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0304-4017(96)01003-5</pubid>
						<pubid idtype="pmpid">8988551</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B11">
				<title>
					<p>Animal reservoir hosts of <it>T. b. gambiense </it>in Zaire: trypanosome infections in two foci in Bas-Zaire</p>
				</title>
				<aug>
					<au>
						<snm>Makumyaviri</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Mehlitz</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Kageruka</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Kazyumba</snm>
						<fnm>GL</fnm>
					</au>
					<au>
						<snm>Molisho</snm>
						<fnm>D</fnm>
					</au>
				</aug>
				<source>Trop Med Parasitol</source><pubdate>1989</pubdate>
				<volume>40</volume>
				<fpage>258</fpage>
				<lpage>62</lpage>
				<xrefbib>
					<pubid idtype="pmpid">2617030</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B12">
				<title>
					<p>Growth and mortality in sheep and goats under high tsetse challenge in Kenya</p>
				</title>
				<aug>
					<au>
						<snm>Masiga</snm>
						<fnm>DK.</fnm>
					</au>
					<au>
						<snm>Okech</snm>
						<fnm>G.</fnm>
					</au>
					<au>
						<snm>Irungu</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Ouma</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Wekesa</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Ouma</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Guya</snm>
						<fnm>SO</fnm>
					</au>
					<au>
						<snm>Ndung'u</snm>
						<fnm>JM</fnm>
					</au>
				</aug>
				<source>Trop Anim Health Pro</source><pubdate>2002</pubdate>
				<volume>34</volume>
				<fpage>489</fpage>
				<lpage>501</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1023/A:1021241220575</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B13">
				<title>
					<p>The economic effects of trypanosomiasis in sheep and goats of a range research station in Kenya</p>
				</title>
				<aug>
					<au>
						<snm>Griffin</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Allonby</snm>
						<fnm>EW</fnm>
					</au>
				</aug>
				<source>Trop Anim Health Pro</source><pubdate>1979</pubdate>
				<volume>11</volume>
				<fpage>127</fpage>
				<lpage>132</lpage>
			</bibl>
			<bibl id="B14">
				<title>
					<p>Financial implication of rearing sheep and goats under natural trypanosomosis challenge at Galana ranch Kenya</p>
				</title>
				<aug>
					<au>
						<snm>Irungu</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Nyamwaro</snm>
						<fnm>SO</fnm>
					</au>
					<au>
						<snm>Masiga</snm>
						<fnm>DK</fnm>
					</au>
				</aug>
				<source>Trop Anim Health Pro</source><pubdate>2002</pubdate>
				<volume>34</volume>
				<fpage>503</fpage>
				<lpage>513</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1023/A:1021293204645</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B15">
				<title>
					<p>Epidemiological relationship of <it>Trypanosoma brucei </it>stock from Southeast Uganda: Evidence for different population structure in human-infective and non-human infective</p>
				</title>
				<aug>
					<au>
						<snm>Hide</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Welburn</snm>
						<fnm>SC</fnm>
					</au>
					<au>
						<snm>Tait</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Maudlin</snm>
						<fnm>I</fnm>
					</au>
				</aug>
				<source>Parasitol</source><pubdate>1994</pubdate>
				<volume>109</volume>
				<fpage>95</fpage>
				<lpage>111</lpage>
			</bibl>
			<bibl id="B16">
				<title>
					<p>Prevalence of domestic animal trypanosomiasis in the Fontem sleeping sickness focus, Cameroon</p>
				</title>
				<aug>
					<au>
						<snm>Asoganyi</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Suh</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Tetuh</snm>
						<fnm>MD</fnm>
					</au>
				</aug>
				<source>Rev Elev Med Vet Trop</source><pubdate>1990</pubdate>
				<volume>43</volume>
				<fpage>69</fpage>
				<lpage>74</lpage>
			</bibl>
			<bibl id="B17">
				<title>
					<p>Identification of human-infective trypanosomes in animal reservoir of sleeping sickness in Uganda by means of serum-resistance-associated (SRA) gene</p>
				</title>
				<aug>
					<au>
						<snm>Welburn</snm>
						<fnm>SC</fnm>
					</au>
					<au>
						<snm>Picozzi</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Fevre</snm>
						<fnm>EM</fnm>
					</au>
					<au>
						<snm>Coleman</snm>
						<fnm>PG</fnm>
					</au>
					<au>
						<snm>Odiit</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Carrington</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Maudlin</snm>
						<fnm>I</fnm>
					</au>
				</aug>
				<source>Lancet</source><pubdate>2001</pubdate>
				<volume>358</volume>
				<fpage>2017</fpage>
				<lpage>2019</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0140-6736(01)07096-9</pubid>
						<pubid idtype="pmpid" link="fulltext">11755607</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B18">
				<title>
					<p>The human serum resistance associated gene is ubiquitous and conserved in <it>T. b. rhodesiense </it>throughout East Africa</p>
				</title>
				<aug>
					<au>
						<snm>Gibson</snm>
						<fnm>W</fnm>
					</au>
					<au>
						<snm>Backhous</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Griffiths</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Infect Genet Evol</source><pubdate>2002</pubdate>
				<volume>1</volume>
				<fpage>207</fpage>
				<lpage>214</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S1567-1348(02)00028-X</pubid>
						<pubid idtype="pmpid" link="fulltext">12798017</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B19">
				<title>
					<p>The serum resistance-associated gene as a diagnostic tool for the detection of Trypanosoma brucei rhodesiense</p>
				</title>
				<aug>
					<au>
						<snm>Radwanska</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Chamekh</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Vanhamme</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Claes</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Magez</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Magnus</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>De Baetselier</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Buscher</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Pays</snm>
						<fnm>E</fnm>
					</au>
				</aug>
				<source>Am J Trop Med Hyg</source><pubdate>2002</pubdate>
				<volume>67</volume>
				<fpage>684</fpage>
				<lpage>690</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">12518862</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B20">
				<title>
					<p>An improved parasitological technique for the diagnosis of African trypanosomiasis</p>
				</title>
				<aug>
					<au>
						<snm>Murray</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Murray</snm>
						<fnm>PK</fnm>
					</au>
					<au>
						<snm>Mclntyre</snm>
						<fnm>WM</fnm>
					</au>
				</aug>
				<source>Trans R Soc Trop Med Hyg</source><pubdate>1977</pubdate>
				<volume>71</volume>
				<fpage>325</fpage>
				<lpage>326</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/0035-9203(77)90110-9</pubid>
						<pubid idtype="pmpid">563634</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B21">
				<title>
					<p>Trypanosomosis in Goats in Zambia</p>
				</title>
				<aug>
					<au>
						<snm>Bealby</snm>
						<fnm>KA</fnm>
					</au>
					<au>
						<snm>Connor</snm>
						<fnm>RJ</fnm>
					</au>
					<au>
						<snm>Rowlands</snm>
						<fnm>GJ</fnm>
					</au>
				</aug>
				<source>ILRI (International Livestock Research Institute), Nairobi, Kenya</source><pubdate>1996</pubdate>
				<fpage>88</fpage>
			</bibl>
			<bibl id="B22">
				<title>
					<p>Prevalence of tsetse fly and ruminant trypanosomosis in Katsina-Ala Local Government Area, Nigeria</p>
				</title>
				<aug>
					<au>
						<snm>Kalu</snm>
						<fnm>AU</fnm>
					</au>
					<au>
						<snm>Uzoukwu</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Ikeme</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Roum Arch Microbiol Immunol</source><pubdate>1996</pubdate>
				<volume>55</volume>
				<fpage>341</fpage>
				<lpage>52</lpage>
				<xrefbib>
					<pubid idtype="pmpid">9558969</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B23">
				<title>
					<p>Health and productivity of traditionally managed Djallonke sheep and West African dwarf goats under high and moderate trypanosomosis risk</p>
				</title>
				<aug>
					<au>
						<snm>Osear</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Goossens</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Kora</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Gaye</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Darboe</snm>
						<fnm>L</fnm>
					</au>
				</aug>
				<source>Vet Parasitol</source><pubdate>1999</pubdate>
				<volume>82</volume>
				<fpage>101</fpage>
				<lpage>109</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0304-4017(99)00011-4</pubid>
						<pubid idtype="pmpid" link="fulltext">10321582</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B24">
				<title>
					<p>Detection of <it>T. brucei</it>, <it>T. congolense </it>and <it>T. vivax </it>infections in cattle, sheep and goats using latex agglutination</p>
				</title>
				<aug>
					<au>
						<snm>Kayang</snm>
						<fnm>BB</fnm>
					</au>
					<au>
						<snm>Bosompem</snm>
						<fnm>KM</fnm>
					</au>
					<au>
						<snm>Assoku</snm>
						<fnm>RK</fnm>
					</au>
					<au>
						<snm>Awumbla</snm>
						<fnm>B</fnm>
					</au>
				</aug>
				<source>Int J Parasiot</source><pubdate>1997</pubdate>
				<volume>27</volume>
				<fpage>83</fpage>
				<lpage>7</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0020-7519(96)00160-9</pubid>
						<pubid idtype="pmpid" link="fulltext">9076533</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B25">
				<title>
					<p>Diet activity patterns and host preferences of <it>Glossina fuscipes fuscipes </it>(Diptera: Glossinidae) along the shores of Lake Victoria, Kenya</p>
				</title>
				<aug>
					<au>
						<snm>Mohamed-Ahmad</snm>
						<fnm>MM</fnm>
					</au>
					<au>
						<snm>Odulaja</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Bull Ent Res</source><pubdate>1997</pubdate>
				<volume>89</volume>
				<fpage>179</fpage>
				<lpage>186</lpage>
			</bibl>
			<bibl id="B26">
				<title>
					<p>Isolation of <it>Trypanosoma brucei </it>from the monitor lizard (<it>Varanus niloticus</it>) in an endemic focus of Rhodesian sleeping sickness in Kenya</p>
				</title>
				<aug>
					<au>
						<snm>Njagu</snm>
						<fnm>Z</fnm>
					</au>
					<au>
						<snm>Mihok</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Kokwaro</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Verloo</snm>
						<fnm>D</fnm>
					</au>
				</aug>
				<source>Acta Trop</source><pubdate>1999</pubdate>
				<volume>72</volume>
				<fpage>137</fpage>
				<lpage>148</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0001-706X(98)00092-8</pubid>
						<pubid idtype="pmpid" link="fulltext">10206114</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B27">
				<aug>
					<au>
						<snm>Hoare</snm>
						<fnm>CA</fnm>
					</au>
				</aug>
				<publisher>trypanosomes of mammals. Blackwell scientific publications. Oxford and Edinburgh</publisher>
				<pubdate>1972</pubdate>
				<fpage>483</fpage>
				<lpage>484</lpage>
			</bibl>
			<bibl id="B28">
				<title>
					<p>Sensitive detection of trypanosomes in tsetse flies by DNA amplification</p>
				</title>
				<aug>
					<au>
						<snm>Masiga</snm>
						<fnm>DK</fnm>
					</au>
					<au>
						<snm>Smyth</snm>
						<fnm>AJ</fnm>
					</au>
					<au>
						<snm>Bromidge</snm>
						<fnm>TJ</fnm>
					</au>
					<au>
						<snm>Hayes</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Gibson</snm>
						<fnm>WC</fnm>
					</au>
				</aug>
				<source>Int J Parasitol</source><pubdate>1992</pubdate>
				<volume>22</volume>
				<fpage>909</fpage>
				<lpage>918</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid">1459784</pubid>
						<pubid idtype="doi">10.1016/0020-7519(92)90047-O</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B29">
				<title>
					<p>New molecular marker for <it>Trypanosoma </it>(<it>Duttonella</it>) <it>vivax </it>identification</p>
				</title>
				<aug>
					<au>
						<snm>Morlais</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Ravel</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Grebaut</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Dumas</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Cuny</snm>
						<fnm>G</fnm>
					</au>
				</aug>
				<source>Acta Trop</source><pubdate>2001</pubdate>
				<volume>80</volume>
				<fpage>207</fpage>
				<lpage>213</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0001-706X(01)00160-7</pubid>
						<pubid idtype="pmpid" link="fulltext">11700177</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
		</refgrp>
	</bm>
</art>

